Genomewide search of the genes tagged with the co

Authors: Deepali Pathak Jyoti Srivastava Rana Samad Iqbal Parwez Sudhir Kumar Sher Ali

Publish Date: 2010/05/18

Volume: 18, Issue: 4, Pages: 441-458

PDF Link

Abstract

Minisatellites have been implicated with chromatin organization and gene regulation but mRNA transcripts tagged with these elements have not been systematically characterized The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 336 repeat loci across the tissues in water buffalo Bubalus bubalis Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 336 repeat loci 5′ CCTCCAGCCCTCCTCCAGCCCT 3′ we conducted minisatelliteassociated sequence amplification MASA and identified 29 mRNA transcripts These transcripts were cloned and sequenced Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database Using realtime PCR we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung Further 21 transcripts were found to be conserved across the species seven were specific to bovid whereas one was exclusive to the buffalo genome The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library This approach may be exploited for the development of tissuespecific mRNA fingerprints in the context of genome analysis and functional and comparative genomics

Keywords: