Endothelial Cells in Coculture Enhance Embryonic

Authors: Dodanim TalaveraAdame Gordon Wu Yao He Tina T Ng Ankur Gupta Silvia Kurtovic Jae Y Hwang Daniel L Farkas Donald C Dafoe

Publish Date: 2011/02/05

Volume: 7, Issue: 3, Pages: 532-543

PDF Link

Abstract

Endothelial cells ECs represent the major component of the embryonic pancreatic niche and play a key role in the differentiation of insulinproducing β cells in vivo However it is unknown if ECs promote such differentiation in vitro We investigated whether interaction of ECs with mouse embryoid bodies EBs in culture promotes differentiation of pancreatic progenitors and insulinproducing cells and the mechanisms involved We developed a coculture system of mouse EBs and human microvascular ECs HMECs An increase in the expression of the pancreatic markers PDX1 Ngn3 Nkx61 proinsulin GLUT2 and Ptf1a was observed at the interface between EBs and ECs EBEC No expression of these markers was found at the periphery of EBs cultured without ECs or those cocultured with mouse embryonic fibroblasts MEFs At EBEC interface proinsulin and Nkx61 positive cells coexpressed phosphoSmad1/5/8 pSmad1/5/8 Therefore EBs were treated with HMEC conditioned media HMECCM suspecting soluble factors involved in bone morphogenetic protein BMP pathway activation Upregulation of PDX1 Ngn3 Nkx61 insulin1 insulin2 amylin SUR1 GKS and amylase as well as downregulation of SST were detected in treated EBs In addition higher expression of BMP2/4 and their receptor BMPR1A were also found in these EBs Recombinant human BMP2 rhBMP2 mimicked the effects of the HMECCM on EBs Noggin NOG a BMP antagonist partially inhibited these effects These results indicate that the differentiation of EBs to pancreatic progenitors and insulinproducing cells can be enhanced by ECs in vitro and that BMP pathway activation is central to this processType 1 diabetes mellitus T1DM affects approximately one million Americans and results in devastating morbidity and accelerated mortality from neurovascular complications 1 Transplantation of a functioning β cell mass in the form of a vascularized whole organ allograft or isolated islets can provide normoglycemia without the need for exogenous insulin injections or the threat of hypoglycemia 2 However the whole organ transplantation approach is limited by the risks of surgery Islet transplantation though safe often requires collection of islets from several donors and the graft is threatened by allorejection and recurrence of autoimmunity Both approaches even if uniformly successful would be limited by the organ donor shortage One promising source of islets is embryonic stem cells ESCs which can be expanded and repeatedly grafted to attain the target quantity of insulin secretion Under the appropriate influences ESCs are able to differentiate into insulinproducing cells 3 4 5 6 7 8 9 10 11 In vivo and in vitro studies have demonstrated that endothelial cells ECs are required for βcell differentiation 12 In addition we recently described that quail chorioallantoic membranes CAMs composed of abundant blood vessels promote the differentiation of mouse embryoid bodies EBs to different cell lineages 13 ECs provide basement membrane components such as laminins and integrins eg beta1integrin that are crucial for insulin gene expression in pancreatic progenitors and vascularization within the islets of Langerhans 14 15 16 17 Because overexpression of vascular endothelial growth factorA VEGFA an angiogenic factor improves the rate of success of islet transplants and hence reversal of hyperglycemia an important role of ECs in islet cell maintenance has been suggested 18 It is known that ECs also elaborate and secrete factors involved in organogenesis such as bone morphogenetic proteins BMPs 19 20 BMP signaling controls several developmental processes involved in pancreatic cell proliferation and differentiation 21 22 Although the participation of ECs in βcell differentiation and function has been well studied in vivo 12 14 15 16 17 the influence of these cells in the specific differentiation of ESCs into insulinproducing β cells as well as the factors involved have not been fully explored in vitro We hypothesize that the in vitro interaction between ESCderived EBs and ECs cells EBEC may augment the differentiation of pancreatic endocrine progenitors and insulinproducing cells and these effects are mediated by endothelialderived factors such as BMPs Our results indicate that ECs cocultured with EBs promote EB cell differentiation to pancreatic endocrine progenitors and insulinproducing βlike cells Furthermore BMP pathway activation plays an important role in the differentiation process observed at the cellcell interface in our coculture systemMouse ESC line R1 from strains 129/Sv x 129/SvCP F1 35day blastocyst Samuel Lunenfeld Research Institute ON Canada passage 2025 were plated on mitomycin C Sigma St Louis MO inactivated mouse embryonic fibroblasts MEFs ATCC Manassas VA Culture medium for maintenance of these cells in their undifferentiated state consisted of Dulbecco Modified Eagle Medium with high glucose DMEMH ATCC Manassas VA supplemented with 15 heatinactivated fetal bovine serum FBS Omega Scientific Inc Tarzana 1 mM Sodium Pyruvate 01 mM nonessential aminoacids NEAA 200 μM Lglutamine Invitrogen Grand Island NY 1000 U/mL leukemia inhibitor factor LIF Chemicon Temecula CA and 100 μM βmercaptoethanol Sigma St Louis MO MEFs were grown at 37oC under 10 CO2 in DMEMH supplemented with 15 FBS To induce formation of EBs the ESCs were cultured in hanging drops after disaggregating with accutase Innovative Cell Technologies San Diego CA Six hundred cells were plated in each drop of 20 μL hanging on the lid of a Petri dish for two days The medium used was the same as described above but without LIF and supplemented with 20 heatinactivated FBS After two days in hanging drops more medium was added to EBs that grew in suspension for three more days The HMEC cell line was donated by E W Ades and F J Candal from the CDC Atlanta GA and T J Lawley Emory University Atlanta GA These cells retain specific markers for microvascular endothelial cells 23 24 Confluent monolayers were grown at 37oC under 5 CO2 in MCDB131 medium Invitrogen Carlsbad CA supplemented with 200 μM Lglutamine Invitrogen Carlsbad CA 10 FBS Omega Scientific Tarzana CA and 100 μg/mL Endothelial Cell Growth Supplement ECGS Upstate Temecula CA Cells were used at passages 20 to 25 Primary cultures of mouse aortic endothelial cells mAECs were kindly donated by Dr M Arditi Division of Pediatric Infectious Diseases and Cardiology Atherosclerosis Research Center Cedars Sinai Medical Center Los Angeles CA The method used for isolation of these cells that express specific endothelialcell markers has been previously described 25 Confluent monolayers of mAECs grew in identical conditions as described for HMECs see above The cells were used at passages 7 to 10 Confluent monolayer of EOMA cells hemangioendothelioma ATCC Manassas VA grew in DMEMH supplemented with 10 FBS For coculturing experiments 2530 EBs were taken with a Pasteur pipette and placed into a 12well plate with glass coverslips precoated with 01 gelatin type A Sigma St Louis MO After 24 hrs ECs were plated at subconfluency 75X103 cells/mL together with growing EBs Then the medium was changed to medium with knockout serum replacer KOSR to avoid further differentiation induced by FBS The coculture continued for 15 days At this time the EBs were 20 days of age EBd20 In other experiments ECs were plated on 12 mm Millicell filter inserts Millipore Billerica MA with EBs on the bottom of the wells of a 24well plate to avoid cellcell contact After 15 days in coculture the EBs were analyzed In another group of experiments EBs were cultured without ECs for 15 days in HMEC conditioned medium HMECCM or recombinant human BMP2 rhBMP2 EBs cultured alone or cocultured with MEFs were used as controls To evaluate cell viability ECs EB cultured alone EB cocultured with ECs and EBs treated with HMECCM were disassociated after 15 days A sample of the cell suspension was incubated with trypan blue and the cells were counted using a dualchamber hemocytometer To evaluate apoptosis we used antiPARP antibody Millipore Billerica MA in all EB groups and ECs after 15 days in culture A mouse insulinoma cell line betaTC6 ATCC Manassas VA was also used as a control Suitable immunodetection of islet markers was performed in these cells Supplementary Fig 1 Subconfluent monolayers were grown at 37oC under 5 CO2 in DMEMH supplemented with 10 FBSHMECs became confluent at day 6 after plating At this time the media was replaced by media supplemented with KOSR collected and filtered 022 μm after 24 hrs to be used as HMECCM Then it was added directly to growing EBs The media was replaced every two days rhBMP2 and rhBMP4 were used at 100 ng/mL and 30 ng/mL respectively RD Systems Inc Minneapolis MN NOG was used to antagonize BMP bioactivities as previously reported 26 It was used at 100 ng/mL RD Systems Inc Minneapolis MN and added to ECCM EBs treated with HMECCM HMECCM + NOG or BMP2/4 were analyzed after 15 daysEBs plated on coverslips and cocultured with ECs for 15 days were fixed with paraformaldehyde 4 Polysciences Inc Warrington PA and permeabilized with 03 triton X100 After rinsing with PBS cells were blocked with PBS/5 BSA for 1 h and exposed overnight using antibodies to proinsulin glucose transporter2 GLUT2 pancreatic and duodenal homeobox factor1 PDX1 PARP AB3565 Millipore Billerica MA neurogenin 3 Ngn3 Lifespan Biosciences Seattle WA NK homeobox 61 Nkx61 DSHB University of Iowa IA islet1 Isl1 pancreas transcription factor 1 alpha PTF1a abcam San Francisco CA platelet/endothelial cell adhesion molecule CD31 BD Biosciences Pharmingen San Diego CA phosphoSmad1/5/8 pSmad1/5/8 Cell Signaling Danvers MA mouse IgG1 rabbit IgG and rat IgG2a isotype controls Santa Cruz Biotechnology Inc Santa Cruz CA The secondary antibodies used were Alexa Fluor 555 goat antirabbit IgG Alexa Fluor 555 goat antimouse IgG Alexa Fluor 488 goat antimouse IgG Alexa Fluor 594 goat antirat IgG Alexa Fluor 488 goat antirat IgG Molecular Probes Eugene OR Images were acquired with a multipurpose zoom microscope Nikon AZ 100 USA http//wwwnikoncom/ attached to a DSQi1 Highsensitivity CCD Camera http//wwwnikoncom/ and analyzed using an imaging software NISElements AR 310 Nikon Instruments Melville NY and the image tools of ImageJ 130v software Wayne Rasband National Institutes of Health USATotal RNA was isolated from 100 EBs growing under the different conditions described using RNA easy mini kit Qiagen Valencia CA After cDNA synthesis using a QuantiTect Reverse Transcription kit Qiagen Valencia CA quantitative realtime RTPCR qRTPCR analysis was performed using a SYBR Green RTPCR kit Qiagen Valencia CA and the LightCycler instrument AB Applied Biosystems Foster City CA http//www3appliedbiosystemscom/AB Home/indexhtm PCR cycle conditions included a first step for initial polymerase activation for 10 min at 95°C and 45 cycles of denaturation at 94°C for 30 s annealing at 60°C for 20 s and elongation at 72°C for 30 sThe forward and reverse primers used all sequences are 5’3’ for mouse genes were as follows Amylase ATACTCTGCTTGGGACTTTAACGA and CAGAAGGCCAGTCAGACGA Amylin GCCACGTGTGCCACACA and GTTGTTGCTGGAACGAACCA BMP2 CTGCCTGCACCCTGTTCTCT and GTTCAAACACATATCCCTGGAAAGA BMP4 GGTCCAGGAAGAAGAATAA and GGTACAACATGGAAATGG BMPR1A GAAGTTGCTGTATTGCTGA and GTAATACAACGACGAGCC GAPDH ATTGACCACTACCTGGGCAA and GAGATACACTTCAACACTTGACCT GCG GCACATTCACCAGCGACTACAG and GGGAAAGGTCCCTTCAGCATGTCT GKS GAGTGCTCAGGATGTTAAGGATCTG and GCTTTTGAGACCCGTTTTGTG GLUT2 GGATAAATTCGCCTGGATGA and TTCCTTTGGTTTCTGGAACT Insulin1 AACAGCATCTTTGTGGTCCC and CACTTGTGGGTCCTCCACTT Insulin2 GGCTCTCTACCTGGTGTGT and TGCAGCACTGATCTACAATG Isl1 CACAGCACCAGCATCCTCTCT and GAGGGAGTAATGTCCACAGTGAAA Kir62 GGACCTCCGAAAGAGCATGA and GCGCACCACCTGCATGT MafA CTTCAGCAAGGAGGAGGTCATC and CGTAGCCGCGGTTCTTGA NeuroD1 CGCATCATGAGCGAGTCATG and GACGTGCCTCTAATCGTGAAAGA Ngn3 ACAGGCCCAAGAGCGAGTT and TTCTTGCGCCGGCTTCT Nkx22 CAAATTTCGCTCCTTCGTTGTAA and ATACAGGCCCATCCAGAACGT Nkx61 TCAGGTTCAAGGTCTGGTTCCA and CGGTCTCCGAGTCCTGCTT Pax4 GCCGAGGCACTGGAGAAA and CGGGCCACTGAATCTGGAT Pax6 ACCTGTCTCCTCCTTCACATCAG and TTGGTGAGGGCGGTGTCT PDX1 ATGAAATCCACCAAAGCTC and GATGTGTCTCTCGGTCAAGT SST CGAGCCCAACCAGACAGAGA and CATTGCTGGGTTCGAGTTGG SUR1 CCTCCAGAAGGTGGTGATGAC and TCTGCACTCAGGATGGTGTGTAC The forward and reverse primers used all sequences are 5’3’ for human genes were as follows BMP2 AAAGGGCATCCTCTCCACAA and AGGCGTTTCCGCTGTTTG BMP4 CCAAGCGTAGCCCTAAGCAT and GGCGCCGGCAGTTCTT GAPDH AGCCACATCGCTCAGACACC and GTACTCAGCGGCCAGCATCG Total RNA from betaTC6 cells American Type Culture Collection Manassas VA mouse pancreas Clontech Mountain View CA MEFs and ECs was used as positive and negative controls respectively Additionally RNA not treated with Reverse Transcriptase No RT was used as internal control All samples were run in triplicate and PCR products were observed by gel electrophoresis on 2 agarose ethidium bromidestained gels Analysis was performed using 7300 Sequence Detection Software SDS Version 13 Software Core Application AB Applied Biosystems Foster City CA http//www3appliedbiosystemscom/AB Home/indexhtm Following qRTPCR a dissociation curve was run to detect primer dimmers contaminating DNA and PCR products from misannealed primers For quantification we used a standard curve obtained by running a glyceraldehyde 3phosphate dehydrogenase GAPDHplasmid with a known copynumber value based on its molecular weight Automatic baseline and threshold feature Ct of the SDS software auto Ct was performed and the system considered Ct values established in the geometric phase of the amplification curve for each marker with minimal standard deviation The standard curve was then used as a reference for extrapolating quantitative information for mRNA targets of unknown concentrations Then the number of copies of each specific marker was divided by the number of copies of GAPDH for normalization mouse housekeeping gene

Keywords: