Regulation of Sirtuin 3Mediated Deacetylation of

Authors: Fan Sun Yanna Si Hongguang Bao Yajie Xu XiaoXiao Pan Lingqing Zeng Ling Jing

Publish Date: 2017/02/25

Volume: 37, Issue: 8, Pages: 1457-1464

PDF Link

Abstract

The present study aimed to investigate cognitive dysfunction in the hippocampus induced by sepsisassociated encephalopathy SAE via acetylation of cyclophilin D CypD and opening of mitochondrial permeability transition pore It also explored whether activating sirtuin 3 SIRT3 can mediate deacetylation of CypD and prevent the development of SAE Male mice were randomly assigned to six groups sham group cecal ligation puncture group CypD siRNA transfection CyPDSI group CypD control siRNA transfection CypDc group SIRT3 overexpression vector pcDNA31 SIRT3p group and SIRT3 empty vector pcDNA31 SIRT3v group n = 18 The CyPDSI and CypDc groups were transfected with CypD siRNA and CypD control siRNA respectively The SIRT3p and SIRT3v groups were injected with SIRT3 pcDNA31 and vector pcDNA31 respectively The learning and memory function was assessed using the learning version of the Morris water maze test Then cell apoptosis and the levels of CypD acetylated CypD SIRT3 interleukin 6 IL6 tumor necrosis factorα TNFα and caspase3 in the hippocampus were determined The levels of CypD and acetylation of CypD increased in the hippocampus induced by SAE Increasing SIRT3 and decreasing CypD can attenuate cognitive impairment and neuroapoptosis and protect the integrity of mitochondrial membrane from damage and restore the protein expressions of IL6 TNFα and caspase3 Activating SIRT3mediated deacetylation of CypD attenuated learning and memory dysfunction induced by SAEIt is universally acknowledged that severe sepsis is related to multisystem damage including brain dysfunction and sepsisassociated encephalopathy SAE is one of the severe central nervous system complications in patients in intensive care units for its cognitive dysfunction Cotena and Piazza 2012 SAE is associated with increased morbidity and mortality and it can influence the shortterm outcome and longterm recovery of patients with SAE Cotena and Piazza 2012 Widmann et al 2014Of most importance to the pathogenesis of SAE is the mitochondrial dysfunction Wu et al 2015 Bozza et al 2013 The involvement of mitochondria is far beyond energy production It is involved in diverse metabolic pathways and also have significant effect for cells and the function of the organism Zampieri et al 2011 A large amount of evidence indicates that mitochondrial dysfunction induced by SAE follows the opening of mitochondrial permeability transition pore mPTP Comim et al 2008 Cyclophilin D CypD an apoptosisregulated protein locates in the mitochondrial matrix which can be translocated to the inner mitochondrial membrane and plays an important role in regulating mPTP opening Kim et al 2014Previous studies also showed that sirtuins which are part of nicotinamide adenine dinucleotide NAD+dependent deacetylases can regulate the acetylation of protein Hill et al 2009 Sirtuins are regarded as “metabolic sensors” which can encode seven sirtuin isoforms SIRT1–SIRT7 SIRT3 is studied the most with its location in the mitochondria Houtkooper et al 2012 Lombard et al 2007 The evidence points out that CypD can be deacetylated by SIRT3 which results in inhibiting mPTP opening Hafner et al 2010 Activating SIRT3 can attenuate mitochondrial dysfunction and neurological impairment after traumatic brain injury in aged mice Wang et al 2016 We know that CypD can facilitate the opening of mPTP and trigger synaptic degeneration leading to Alzheimer’s disease Du et al 2014 However the effects of SIRT3mediated deacetylation of CypD in cognitive impairment induced by SAE remain unknownThis study aimed to investigate cognitive dysfunction in mice induced by SAE via acetylation of CypD and promotion of mPTP opening Activating SIRT3 can mediate the deacetylation of CypD and prevent the development of SAE This study also opens new perspectives for developing preventive therapies against the development of cognitive dysfunction induced by SAEThe experimental procedures were approved by the animal ethical committee of the Nanjing Medical University China and performed in strict accordance with the National Institutes of Health Guide for the Use of Laboratory Animals and all efforts were made to minimize animal suffering Male C57BL/6J mice age 3–4 months weighing 20–30 g were housed in controlled cages temperature 22–24 °C and 60–65 humidity with a 12h light–dark cycle at the Animal Experiment Centre Nanjing Medical University China The mice were randomly assigned to six groups sham group cecal ligation puncture CLP group CypD siRNA transfection CyPDSI group CypD control siRNA transfection CypDc group SIRT3 overexpression vector pcDNA31 SIRT3p group and SIRT3 empty vector pcDNA31 SIRT3v group n = 18The siRNA against mouse CypD was synthesized by Nanjing Kaiji Biotech Nanjing China The pairs were 5ACACCAATGGCTCTCAGTTC3 forward and 5AGTGGCCTTCCTCATACTCA 3 reverse Hu et al 2015 The entransterin vivo transfection reagent 1866811 was purchased from Engreen Biosystem Co Ltd China The Entransterin vivo–siRNA mixture was prepared strictly in accordance with the manufacturer’s instructions The mice were well tolerated with 50 μL siRNA infusion and no signs of neurotoxicity including vocalization food intake hindlimb paralysis or damage of the nervous system were observed in the preliminary study The CyPDSI and CypDv groups were injected into mice lateral cerebral ventricles with CypD siRNA and CypD control siRNA respectively 3 days before surgeryThe SIRT3 overexpressing vector and the empty vector were purchased from Dharmacon Research Inc Lafayette CO USA The SIRT3p and SIRT3c groups were injected into mice lateral cerebral ventricles with SIRT3Flag and Vec respectively 3 days before surgery

Keywords: