Thymic alterations in mice deficient for the SNARE

Authors: Namita Kanwar Afshin Fayyazi Bianca Backofen Mirko Nitsche Ralf Dressel Gabriele Fischer von Mollard

Publish Date: 2008/10/16

Volume: 334, Issue: 2, Pages: 227-242

PDF Link

Abstract

SNARE solubleNethylmaleimidesensitive factor attachment receptor proteins mediate the recognition and fusion of transport vesicles in eukaryotic cells The SNARE protein VAMP8 also called endobrevin is involved in the fusion of late endosomes and in some pathways of regulated exocytosis In a subset of mice deficient for the SNARE protein VAMP8 a severe alteration of the thymus and in T lymphocyte development was observed and characterized The size of the thymus and the number of thymocytes were dramatically reduced compared with those in heterozygous littermates Further the compartmentalization into cortex and medulla and the organization of the thymus epithelium were disturbed The numbers of all thymocyte subpopulations were reduced with the CD4 and CD8 doublepositive thymocytes being most severely affected The proportion of proliferating thymocytes was reduced and the staining of apoptotic cells in situ and ex vivo indicated an increased number of apoptotic cells Isolated thymocytes of Vamp8 −/− mice were more susceptible to various apoptotic stimuli including glucocorticoids FAS receptor and CD3/CD28mediated signaling in vitro even before an increased number of apoptotic cells was detectable in situ However bone marrow of phenotypically affected Vamp8 −/− mice was readily able to repopulate immunodeficient hosts suggesting that the SNARE protein VAMP8 has a specific function in the thymic stroma affecting the proliferation and apoptosis of T lymphocytes during maturation in the thymusEukaryotic cells contain membraneenclosed compartments with specialized functions these compartments are connected by membrane traffic via transport vesicles Communication between cells is mediated by receptors on the plasma membrane and by the secretion of soluble signaling molecules These proteins are transported to the cell surface via the endoplasmic reticulum Golgi and trans Golgi network Signal transduction can be regulated by the endocytosis of cell surface receptors These receptors can either be targeted from early endosomes via late endosomes to lysosomes for degradation Perret et al 2005 or recycled back to the cell surface for further signaling In addition endosomes can play an active role in certain signaling pathways because they contain specific signal transducers Polo and Di Fiore 2006Complex protein machinery is required for recognition between transport vesicle and target membrane and the subsequent fusion of these membranes SNAREs solubleNethylmaleimidesensitive factor attachment protein receptor play a key role in these processes Jahn and Scheller 2006 The SNAREs found on transport vesicles and target membranes form complexes via their conserved SNARE motifs bridging the gap between both membranes and initiating membrane fusion These SNARE complexes have a conserved structure consisting of four SNARE motifs forming an extended parallel bundle of four αhelices Sutton et al 1998 Whereas most SNAREs contain a single SNARE motif a few SNARE proteins such as SNAP23 and SNAP29 contribute two SNARE motifs to SNARE complexes Specific SNARE complexes have been assigned to specific transport steps Homotypic fusion of late endosomes is mediated by a SNARE complex composed of VAMP8 also called endobrevin vti1b syntaxin 7 and syntaxin 8 in vitro Antonin et al 2000a Transport from late endosomes to lysosomes requires vti1b syntaxin 7 syntaxin 8 and VAMP7 VAMP7 replaces VAMP8 in this transport step Pryor et al 2004 Vamp8 −/− mice are reported to have defects in regulated exocytosis of exocrine zymogen granules and other exocrine secretory granules Wang et al 2004 2007 These data demonstrate that VAMP8 is required for exocytosis in the exocrine system in a complex with syntaxin 4 and SNAP23 VAMP8 is also involved in regulated exocytosis of dense granules alpha granules and lysosomes from platelets Ren et al 2007 and in secretion from mast cells Lippert et al 2007 Here we have set out to extend studies of mice deficient for VAMP8 A particularly obvious phenotype is that these mice have an extremely small thymus Therefore we have concentrated our analysis of the effects of VAMP8 deficiency on thymus morphology and T lymphocyte developmentThe thymus is responsible for the generation of T lymphocytes that respond to foreign antigens but not to selfantigens Starr et al 2003 Hogquist et al 2005 Precursor cells from the bone marrow enter the thymus and undergo multiple and tightly regulated developmental steps which include the rearrangement and expression of T cell receptor TCR genes the positive selection of cells that can interact with selfmajor histocompatibility complex MHC molecules and the negative selection of cells that strongly recognize selfantigens The developing cells undergo phases of intense proliferation however about 98 of the thymocytes that develop in the thymus die by apoptosis because they do not meet the selection criteria Egerton et al 1990 Strasser and Bouillet 2003 The development of thymocytes depends on the interaction with stromal cells which include epithelial cells dendritic cells macrophages and fibroblasts The thymocytes migrate during their development through multiple microenvironments in the cortex and medulla of the thymus Takahama 2006 Each step in development is characterized by the expression of a specific set of cell surface molecules that can be used to analyze the T lymphocyte maturation The most prominent stages are distinguished on the basis of CD4 and CD8 coreceptor expression Immature CD4−CD8− doublenegative DN thymocytes transiently become CD4+CD8+ doublepositive DP thymocytes before CD4+ or CD8+ singlepositive SP T lymphocytes are generated that subsequently leave the thymus and enter the circulation Multiple signaling events are involved in the maturation of T lymphocytes in which the amplitude and duration of signaling is often the key factor for the outcome ie proliferation and progress in maturation or cell death by apoptosis These signaling pathways are controlled by intracellular enzymes regulatory proteins adaptor molecules transcription factors and cell surface receptors The subcellular organization of these signaling pathways could also depend on the function of the SNARE protein machineryWe show herein that the cytoarchitecture of the thymus and subsequently the T lymphocyte development is severely disturbed in a subset of VAMP8deficient mice The apoptosis of thymocytes increases and their proliferation decreases This is the first description of a SNARE protein deficiency leading to severe alterations of the organization of thymic epithelial cells TEC and T cell developmentVamp8 tm1Lex OST20346 Zambrowicz et al 1998 were maintained on a mixed genetic background of 129SvJ and C57BL/6 strains Heterozygous animals were used for breeding All animal experiments were approved by the local government and were in accordance with institutional guidelines for the welfare of animals Heterozygous littermates were always used as controls for the knockout mice Between day 5 and day 16 after birth the weight and health status of the Vamp8 −/− mice were recorded daily to document the phenotype of individual mice DNA was obtained for genotyping from tail biopsies Primers specific for the Vamp8 wildtype allele 5′CCGAAACAAGACAGAGGACTTG3′ and 5′CGTTAGGAATGGAGCAGTTGAC3′ and for the puror cassette of the mutant allele 5′CCGAGTACAAGCCCACGGTG3′ and 5′CGCTGCCCAGACCCTTGCCC3′ were used for polymerase chain reaction PCR amplification and gave products of 290 bp and 400 bp respectivelyFreshly excised tissues were homogenized in TRISbuffered saline 150 mM NaCl 50 mM TRISHCl pH 74 in an UltraTurrax homogenizer The homogenates were supplemented with 01 Triton X100 and protease inhibitors 1 mM phenylmethylsulfonylfluoride 05 μg/ml leupeptin 10 μg/ml pepstatin Total protein 30 µg was resolved by sodium dodecyl sulfatepolyacrylamide gel electrophoresis SDSPAGE and transferred to nitrocellulose membranes PROTRAN Schleicher and Schuell Germany Polyclonal antibodies directed against vti1a vti1b Antonin et al 2000b SNAP29 syntaxin 7 syntaxin 8 Antonin et al 2000a Kreykenbohm et al 2002 and VAMP8 Synaptic Systems Göttingen Germany were used for detection and the bands were visualized by enhanced chemiluminescence Pierce Rockford USA For the detection of VAMP8 1 mg TritonX100free homogenate was subjected to Triton X114 extraction to enrich membrane proteins Bordier 1981 The detergent fraction was concentrated by acetone precipitation

Keywords: