Downregulation of the Long NonCoding RNA Meg3 Pro

Authors: Juan Liu Qing Li Kunshan Zhang Bin Hu Xin Niu Shumin Zhou Siguang Li Yuping Luo Yang Wang Zhifeng Deng

Publish Date: 2016/11/29

Volume: 54, Issue: 10, Pages: 8179-8190

PDF Link

Abstract

Angiogenesis after ischemic brain injury contributes to the restoration of blood supply in the ischemic zone Strategies to improve angiogenesis may facilitate the function recovery after stroke Recent researches have demonstrated that dysfunction of long noncoding RNAs are associated with angiogenesis We have previously reported that long noncoding RNAs lncRNAs are aberrantly expressed in ischemic stroke However little is known about long noncoding RNAs and theirs role in angiogenesis after stroke In this study we identified a rat lncRNAs Meg3 and found that Meg3 was significantly decreased after ischemic stroke Overexpression of Meg3 suppressed functional recovery and decreased capillary density after ischemic stroke Downregulation of Meg3 ameliorated brain lesion and increased angiogenesis after ischemic stroke Silencing of Meg3 resulted in a proangiogenic effect evidenced by increased endothelial cell migration proliferation sprouting and tube formation Mechanistically we showed that Meg3 negatively regulated notch pathway both in vivo and in vitro Inhibition of notch signaling in endothelial cells reversed the proangiogenic effect induced by Meg3 downregulation This study revealed the function of Meg3 in ischemic stroke and elucidated its mechanism in angiogenesis after ischemic strokeStroke is a leading cause of longterm disability in highincome countries and a leading cause of death worldwide Each year ∼795000 people experience a new or recurrent stroke and 87 of the strokes are ischemic 1 So far effective stroke treatments remain limited despite the marked improvements that have been achieved in medical and endovascular recanalization therapy Recent studies have shown that angiogenesis is activated after stroke and that higher microvessel density is associated with less morbidity and longer survival 2 Clinically angiogenesis has important implications because induction of angiogenesis after ischemic stroke stimulates endogenous recovery mechanisms which promote neurogenesis and increase neuronal and synaptic plasticity and therefore improve the neurological outcome 3 Hence proangiogenesis may represent a promising therapeutic strategy which requires more innovative elaborating for patients with ischemic strokeAngiogenesis after stroke is a wellorchestrated sequence of complex biological and molecular events which is precisely regulated by proangiogenic and antiangiogenic factors such as VEGF BDNF and bFGF 4 Long noncoding RNAs lncRNAs which constitute a significant portion of the mammalian genome have emerged as key regulators implicated in angiogenesis 5 A very recent study has demonstrated that the lncRNA MALAT1 regulates endothelial cell function and promotes neovascularization after hindlimb ischemia 6 We have previously demonstrated that lncRNAs are aberrantly expressed in ischemic stroke and involved in the pathophysiology of stroke GSE78200 However whether lncRNAs are involved in the regulation of angiogenesis after ischemic stroke remains poorly definedTo address this issue we analyzed our RNASeq datasets and identified a novel rat lncRNA which was human and mouse maternally expressed gene 3 Meg3 ortholog Meg3 also known as gene trap locus 2 Gtl2 in mouse encodes a long noncoding RNA which is widely expressed in many tissues and cells such as brain and endothelial cells 6 7 Growing evidences suggest that Meg3 is a tumor suppressor lncRNA and its expression is lost in many tumors and cancer cell lines 8 9 10 11 Overexpression of Meg3 has been shown to suppress tumor cell growth and promote cell apoptosis in vitro 12 13 Moreover inactivation of Meg3 leads to a significant increase in expression of notch pathway genes and microvessel density in the brain of Meg3 knockout mice 14 Notch signaling is an evolutionarily wellconserved pathway that plays a crucial role in the regulation of angiogenesis 15 16 Several members of the Notch family are specifically expressed in endothelial cells 17 18 In particular mouse embryos lacking endothelial Notch1 show defects in angiogenesis and vascular development 19 We and other groups have previously shown that notch signaling is activated after ischemic stroke and the upregulated notch promotes angiogenesis in the ischemia brain tissue 20 21 Thus we presently evaluated whether Meg3 is involved in angiogenesis after ischemic stroke and if yes if its mechanism of action is by modulating the notch signalingRNASequencing data GSE78200 was downloaded from Gene Expression Omnibus which included five pairs of rat brain samples Raw reads were cleaned by removing adaptors and low quality reads before assembly Reads from the FASTQ files were mapped to the rat genome RGSC 50/rn5 and splice junctions were identified by TopHat The output files were analyzed by Cufflinks to estimate the transcript abundances Cufflinks generated transcript structure predictions were then compared to the reference annotation Ensembl GTF by Cuffcompare The gene expression level was expressed in fragments per kilobase of exon per million reads mapped FPKM and calculated by the TopHat and Cufflinks package BLASTN analysis of the putative lncRNAs was used to identify the homologous genesTo determine the transcriptional initiation and termination sites of rat MEG3 5′ and 3′ rapid amplification of cDNA end RACE analyses were performed with 5′full RACE and 3′full RACE Core Set kits Takara Bio Japan according to the manufacturer’s instructions The genespecific primers GSPs used for the PCR of the RACE analysis were as follows 5′ RACE MEG3 outer GSP 5′TGATGAACACGAGCACAGATG3′ and 5′ RACE MEG3 inner GSP 5′GGGGGTCCACAAGAAGTTG3′ 3′ RACE MEG3 GSP 5′ CCCCTTGAGTAGAGAGACCCA3′ products were cloned into pMD19T vectors Takara Bio Japan and then sequenced The full length of rat MEG3 was cloned by 5′ and 3′RACE and the PCR primers were as follows forward 5′AGAAGGCGAAGAACTGGAATAGAG3′ and reverse 5′AGTTAAAACAAGAAACATTTATTGAAAGCAC3′ Products were cloned and then sequencedAll animal procedures were approved by the ethics Committee of Shanghai Jiao Tong University and performed according to the guidelines of the US Department of Health for use and care of laboratory animals A total of 268 adult male Sprague–Dawley rats weight 240–250 g were included in the study Data are reported on 160 animals One hundred eight animals were excluded from the study due to no neurologic abnormalities 30 or death 78 The rats were randomly assigned to 4 groups control group rats underwent control lentivirus injection Meg3 group rats underwent Meg3 lentivirus injection shCtrl group rats underwent shCtrl lentivirus injection and shMeg3 group rats underwent shMeg3 lentivirus injection The animal experimental design is illustrated in Fig 2a

Keywords: