A newly identified mutation in an IPF1 binding sit

Authors: M T Malecki P Lebrun M Pezzolesi J H Warram A S Krolewski U S Jhala

Publish Date: 2006/06/02

Volume: 49, Issue: 8, Pages: 1985-1987

PDF Link

Abstract

To the Editor Autosomal dominant diabetes is a heterogeneous subtype of the disease usually characterised by early onset and a primary defect in insulin secretion To date six genes have been found to be associated with earlyonset autosomal dominant diabetes also called MODY Five of them are transcription factors directly or indirectly involved in the process of insulin gene expression 1 Many regulatory enhancer elements including the critical glucose response elements have been identified in the insulin promoter several within the proximal 300–400 bp region Remarkably most transcription factors known to be associated with MODY have been shown to regulate insulin gene expression directly through these sites 2 A search for mutations in the most proximal part of the insulin promoter in a large set of pedigrees with autosomal dominant diabetes resulted in the identification of a −80A→G point mutation within the insulin promoter factor 1 homeodomain transcription factor IPF1 also known as MODY4 and PDX1 binding site of the glucose response region The role of this mutation in susceptibility to diabetes is discussed belowTo test the hypothesis that alterations in the proximal regulatory regions of the insulin gene occur in a subset of patients from families with autosomal dominant diabetes we examined 323 bp immediately upstream of the transcription start site by direct sequencing using the following primers forward 5′tcctggtctaatgtggaaagtggcc3′ reverse 5′atggcagaaggacagtgatctg3′ We screened DNA samples from 94 index cases in families of European descent confirmed to have diabetes segregating as an autosomal dominant disorder The ascertainment and characteristics of these families have been described in a previous study 3 Of the 94 families 45 families had earlyonset diabetes meeting MODY criteria while in 49 families the disease was diagnosed later in life and was considered autosomal dominant lateonset type 2 diabetes The Committee on Human Subjects of the Joslin Diabetes Center approved the study protocol informed consent procedures and written consent to participate were obtainedSequence analysis of the insulin gene promoter in these individuals revealed substitution of an A to G at position −80 in one subject The mutation was confirmed by cloning the PCR product into a TA cloning vector pCR 21 Invitrogen Carlsbad CA USA and sequencing clones representing each allele The mutation changes an evolutionarily wellconserved adenine base residue within the A1 box that constitutes an IPF1 binding site 4 The A1 box is part of a socalled ‘minienhancer’ that is sufficient to confer glucose responsiveness to the insulin gene The −80A→G mutation was not present in a set of 96 unrelated control individuals all Caucasians of European originPedigree genotypes and clinical characteristics of Family A with data for the examined individuals founders and deceased diabetic patients The segregation of −80A→G and D76N mutations is shown Closed symbols subject with diabetes half closed symbols subjects with IGT open symbols subjects with NGT The first line under the symbols is the identification number The second and third lines are the genotype at insulin promoter nucleotide −80 of insulin promoter and at residue 76 of the IPF gene respectively for examined individuals N normal allele m mutant allele The fourth line is the age at diabetes diagnosis for affected members age at death for deceased members and age at examination for others The last line is treatment for diabetes at the time of examination An arrow indicates the index caseFunctional characterisation of the −80A→G mutation a Electro mobility shift assay was performed using nuclear extracts from Min6 insulinoma cells and γP32 ATP labelled wildtype WT lanes 1–5 and mutant MT DNA lane 6 corresponding to a short stretch −91–70 bp around the A→G mutation as described 8 Specificity of DNA binding was ascertained using 50fold excess unlabelled wildtype lane 4 or mutant DNA lane 5 and identification of IPF1 binding activity was determined using an antiIPF1 antibody lane 3 Preimmune serum was used as a control lane 2 b Wildtype and −80A→G mutant human insulin promoterluciferase reporter constructs were transfected into Min6 insulinoma cells −410 to + 10 bp and treated with low 3 mmol/l solid bars or high 24 mmol/l hatched bars glucose Betagalactosidase gal was used as a transfection control and to normalise luciferase activityIn summary sequence differences in the proximal part of the insulin gene promoter are not a major cause of MODY or autosomal dominant lateonset type 2 diabetes This is the first report to identify a naturally occurring mutation in a key enhancer element of the insulin gene promoter All the carriers of this mutation were affected but the genetic background of diabetes in this family seemed to be complex and certainly not limited to the −80A→G substitution While the results of functional studies showed that the mutation had a strong impact on activity of the insulin promoter most carriers of the newly identified variant were characterised by a rather modest diabetic phenotype This discrepancy could be explained by the presence of up to three additional IPF1 binding sites on each allele and the full complement of IPF1 binding sites on the other allele It is possible that impaired function of the insulin promoter with the −80A→G substitution could be unmasked in humans in the presence of other genetic and environmental factors such as obesity and insulin resistance Thus we postulate that −80A→G mutation in the insulin gene promoter may contribute to the genetic background of type 2 diabetes mellitus as a part of an oligogenic or polygenic inheritance

Keywords: